|
Left Crispr |
Right Crispr |
| Crispr ID |
921199624 |
921199633 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:212792379-212792401
|
1:212792425-212792447
|
| Sequence |
CCCAGCACTTTGGGAGGCCGAGG |
CCAGGAGATCGTGACCAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 120847, 1: 270445, 2: 211583, 3: 123288, 4: 170743} |
{0: 1, 1: 230, 2: 13448, 3: 168553, 4: 277262} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|