ID: 921207157_921207173

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 921207157 921207173
Species Human (GRCh38) Human (GRCh38)
Location 1:212858576-212858598 1:212858615-212858637
Sequence CCCAAAGCGGGCACCTTCCCGGT GACAGCCTCGCTGCCGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!