ID: 921220627_921220632

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 921220627 921220632
Species Human (GRCh38) Human (GRCh38)
Location 1:212971186-212971208 1:212971236-212971258
Sequence CCTTTATCCATCGATGGATATTT AAATGATGCTGTTCAGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 194} {0: 1, 1: 0, 2: 1, 3: 24, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!