ID: 921221069_921221074

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921221069 921221074
Species Human (GRCh38) Human (GRCh38)
Location 1:212974299-212974321 1:212974326-212974348
Sequence CCAGGCAGAATGAGGTGAAGAAT TGAAATGCAGGTGGCCCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 217} {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!