ID: 921278707_921278716

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 921278707 921278716
Species Human (GRCh38) Human (GRCh38)
Location 1:213544533-213544555 1:213544565-213544587
Sequence CCGTGGCCCCTCTGTGTGTTCCC CTTGGCCTATCTCCCTGCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 20, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!