ID: 921298524_921298529

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921298524 921298529
Species Human (GRCh38) Human (GRCh38)
Location 1:213727300-213727322 1:213727327-213727349
Sequence CCTCTGTGCAAATACTAAGAAAG CCTTCTGAGATGAGGGTACAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 21, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!