ID: 921327133_921327137

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 921327133 921327137
Species Human (GRCh38) Human (GRCh38)
Location 1:213997474-213997496 1:213997523-213997545
Sequence CCTGATCAGAGAGCAGGAAATGG AACAACAAAGAAAGAGACCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 252} {0: 1, 1: 1, 2: 6, 3: 122, 4: 1219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!