ID: 921328664_921328672

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 921328664 921328672
Species Human (GRCh38) Human (GRCh38)
Location 1:214013766-214013788 1:214013813-214013835
Sequence CCAGGCCACCTCTCCTTTATCTG ACTGCAAGGAGTATGGGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 334} {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!