ID: 921329928_921329939

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 921329928 921329939
Species Human (GRCh38) Human (GRCh38)
Location 1:214025344-214025366 1:214025396-214025418
Sequence CCATTAGGCCTCTAGAAAAGCTG GCTGGCAAAGTATGGCCTATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 144} {0: 1, 1: 0, 2: 10, 3: 99, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!