ID: 921457376_921457384

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 921457376 921457384
Species Human (GRCh38) Human (GRCh38)
Location 1:215388782-215388804 1:215388829-215388851
Sequence CCTCGGGAAACTGACAATCATGG CATCTTAACCACAGTGACTCAGG
Strand - +
Off-target summary {0: 2, 1: 198, 2: 6168, 3: 8578, 4: 6715} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!