ID: 921480490_921480496

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 921480490 921480496
Species Human (GRCh38) Human (GRCh38)
Location 1:215659326-215659348 1:215659357-215659379
Sequence CCTCAAGAAGGCCAGTGTGGCTG GAGTAAGGGCCGGAAAGCAATGG
Strand - +
Off-target summary {0: 2, 1: 7, 2: 20, 3: 76, 4: 378} {0: 1, 1: 0, 2: 0, 3: 7, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!