ID: 921484702_921484706

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 921484702 921484706
Species Human (GRCh38) Human (GRCh38)
Location 1:215702428-215702450 1:215702447-215702469
Sequence CCATTCTCCTTGCCATTTTCAGG CAGGTACACCAATTAAATGTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 113, 3: 1463, 4: 3573} {0: 4, 1: 191, 2: 381, 3: 463, 4: 568}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!