ID: 921485260_921485267

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 921485260 921485267
Species Human (GRCh38) Human (GRCh38)
Location 1:215708044-215708066 1:215708076-215708098
Sequence CCATCATATCTGAAGCAAAAATC AGTGGGAAGAAGGATGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 282} {0: 1, 1: 0, 2: 6, 3: 71, 4: 791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!