ID: 921504022_921504026

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 921504022 921504026
Species Human (GRCh38) Human (GRCh38)
Location 1:215944154-215944176 1:215944200-215944222
Sequence CCAAATTTGGCCAGCTGCCTATT ACAAAAGTAATTATCTTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 114, 4: 414} {0: 1, 1: 0, 2: 4, 3: 44, 4: 583}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!