ID: 921554077_921554083

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 921554077 921554083
Species Human (GRCh38) Human (GRCh38)
Location 1:216576004-216576026 1:216576041-216576063
Sequence CCATTCCTCTTTTTTTCCACTGA GATATTAATTTCCCTGCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 99, 4: 861} {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!