ID: 921626091_921626101

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 921626091 921626101
Species Human (GRCh38) Human (GRCh38)
Location 1:217379467-217379489 1:217379514-217379536
Sequence CCTGGCTTATCTCATTGGGACTG GAGGGCAAACAGAAGCAGGGTGG
Strand - +
Off-target summary No data {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!