|
Left Crispr |
Right Crispr |
| Crispr ID |
921632923 |
921632929 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:217456222-217456244
|
1:217456256-217456278
|
| Sequence |
CCATGCCCACTTGGGCTTTGGGA |
CCACCCCTAGATGCTACTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 4, 3: 31, 4: 228} |
{0: 5, 1: 25, 2: 70, 3: 162, 4: 376} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|