|
Left Crispr |
Right Crispr |
| Crispr ID |
921633706 |
921633717 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:217466466-217466488
|
1:217466510-217466532
|
| Sequence |
CCCTCTGCCTCTGCCTCCCTAAG |
CCACCATGCCTGGCTAAAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 191, 2: 5023, 3: 66082, 4: 154244} |
{0: 1, 1: 13, 2: 76, 3: 543, 4: 1709} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|