ID: 921664043_921664050

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 921664043 921664050
Species Human (GRCh38) Human (GRCh38)
Location 1:217845314-217845336 1:217845367-217845389
Sequence CCAACATAGAAGGCCTGTGGTTT CTTTCTAGGCTCCAGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 218} {0: 1, 1: 0, 2: 0, 3: 14, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!