ID: 921670201_921670207

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 921670201 921670207
Species Human (GRCh38) Human (GRCh38)
Location 1:217916537-217916559 1:217916582-217916604
Sequence CCAGATATGTATGGGTTTTCAAA CATTCTAAGTAGAAGAGGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 29, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!