ID: 921706023_921706030

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 921706023 921706030
Species Human (GRCh38) Human (GRCh38)
Location 1:218323710-218323732 1:218323732-218323754
Sequence CCCACCTCGGCCTCCCTCTCATG GCTTGTTGGCACCCAAAGTCCGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 23, 3: 139, 4: 885} {0: 5, 1: 14, 2: 34, 3: 78, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!