|
Left Crispr |
Right Crispr |
| Crispr ID |
921706023 |
921706033 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:218323710-218323732
|
1:218323737-218323759
|
| Sequence |
CCCACCTCGGCCTCCCTCTCATG |
TTGGCACCCAAAGTCCGGAGGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 23, 3: 139, 4: 885} |
{0: 3, 1: 27, 2: 82, 3: 162, 4: 248} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|