ID: 921706163_921706173

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 921706163 921706173
Species Human (GRCh38) Human (GRCh38)
Location 1:218324264-218324286 1:218324285-218324307
Sequence CCCTGCCAACCCCGCACAAATGA GAACCCGACGCTCTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 9, 3: 12, 4: 100} {0: 1, 1: 0, 2: 4, 3: 16, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!