ID: 921782994_921782998

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 921782994 921782998
Species Human (GRCh38) Human (GRCh38)
Location 1:219190814-219190836 1:219190865-219190887
Sequence CCACTTATGTGGAGTTTTAGAAC CACTCAGTAGTTGCTTGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 27, 4: 192} {0: 1, 1: 2, 2: 0, 3: 12, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!