ID: 921873345_921873350

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921873345 921873350
Species Human (GRCh38) Human (GRCh38)
Location 1:220166393-220166415 1:220166420-220166442
Sequence CCAGGGAACTGACTAAGGAGGTC TGAAGGACTGATTGGCAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144} {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!