ID: 921904981_921904988

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 921904981 921904988
Species Human (GRCh38) Human (GRCh38)
Location 1:220486722-220486744 1:220486771-220486793
Sequence CCTGCTTTCTACCTACTAGATGC AGACACTTCCAAATATCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 19, 3: 208, 4: 708} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!