ID: 921912526_921912530

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 921912526 921912530
Species Human (GRCh38) Human (GRCh38)
Location 1:220565630-220565652 1:220565643-220565665
Sequence CCCTAGCCCAAAAGCTCAGGCTA GCTCAGGCTAAAGACTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 123} {0: 1, 1: 0, 2: 1, 3: 11, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!