ID: 921913306_921913312

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 921913306 921913312
Species Human (GRCh38) Human (GRCh38)
Location 1:220576479-220576501 1:220576510-220576532
Sequence CCTCAGTGGGAGGGTCCTGGAAA GGCAAAGGGTGTGAAAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 280} {0: 1, 1: 0, 2: 2, 3: 20, 4: 217}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!