ID: 921918510_921918516

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 921918510 921918516
Species Human (GRCh38) Human (GRCh38)
Location 1:220641227-220641249 1:220641256-220641278
Sequence CCCTGCACCCTCTGCCAAAATTC TAAAATTCTAACCCTAAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 522} {0: 1, 1: 1, 2: 1, 3: 23, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!