ID: 921930482_921930488

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 921930482 921930488
Species Human (GRCh38) Human (GRCh38)
Location 1:220750226-220750248 1:220750263-220750285
Sequence CCTTCCTATTACTGGAAAGACTT CTGGACACCTTCCAAAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 166} {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!