ID: 921934847_921934854

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921934847 921934854
Species Human (GRCh38) Human (GRCh38)
Location 1:220786923-220786945 1:220786950-220786972
Sequence CCACCTCGCGGAGAAGCCAGCCA CGCCGCCGGCTCCTCCGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 184} {0: 1, 1: 0, 2: 4, 3: 54, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!