ID: 921936640_921936648

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 921936640 921936648
Species Human (GRCh38) Human (GRCh38)
Location 1:220802165-220802187 1:220802207-220802229
Sequence CCTGCAGCATCGCCCTCTGTCAC TGTCCACCCAGGACTCCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 153} {0: 1, 1: 0, 2: 3, 3: 28, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!