|
Left Crispr |
Right Crispr |
| Crispr ID |
921962141 |
921962153 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:221047232-221047254
|
1:221047279-221047301
|
| Sequence |
CCCAGCTCATCTCACTGGGACTG |
GAGGGTGAACAGAAGTAGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 53, 1: 268, 2: 806, 3: 1033, 4: 1193} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|