ID: 922027406_922027412

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922027406 922027412
Species Human (GRCh38) Human (GRCh38)
Location 1:221763660-221763682 1:221763697-221763719
Sequence CCAAGATGGCACCTTGTTGCTGT GTGAACACTGTGTCCTCACATGG
Strand - +
Off-target summary No data {0: 2, 1: 30, 2: 108, 3: 290, 4: 1062}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!