ID: 922101587_922101603

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 922101587 922101603
Species Human (GRCh38) Human (GRCh38)
Location 1:222481815-222481837 1:222481867-222481889
Sequence CCCCACCCAGCAACTCCCTGGCC TCTCAACACCACCACGACCCTGG
Strand - +
Off-target summary {0: 16, 1: 9, 2: 27, 3: 59, 4: 666} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!