ID: 922101590_922101603

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 922101590 922101603
Species Human (GRCh38) Human (GRCh38)
Location 1:222481820-222481842 1:222481867-222481889
Sequence CCCAGCAACTCCCTGGCCTCCTC TCTCAACACCACCACGACCCTGG
Strand - +
Off-target summary {0: 31, 1: 18, 2: 13, 3: 67, 4: 529} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!