ID: 922101592_922101604

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 922101592 922101604
Species Human (GRCh38) Human (GRCh38)
Location 1:222481830-222481852 1:222481872-222481894
Sequence CCCTGGCCTCCTCCCCTACTTCT ACACCACCACGACCCTGGTCAGG
Strand - +
Off-target summary {0: 13, 1: 15, 2: 15, 3: 78, 4: 777} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!