ID: 922140492_922140497

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 922140492 922140497
Species Human (GRCh38) Human (GRCh38)
Location 1:222880716-222880738 1:222880768-222880790
Sequence CCTGTGTGGCGAGAGAAGACTAC TAAAATGTCTGGGCCAGACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62} {0: 1, 1: 1, 2: 7, 3: 105, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!