ID: 922145611_922145617

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922145611 922145617
Species Human (GRCh38) Human (GRCh38)
Location 1:222940764-222940786 1:222940785-222940807
Sequence CCCATCAGCTGTGATAGTTTAAC ACTGAGGTACAGGTGGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 103} {0: 1, 1: 1, 2: 1, 3: 55, 4: 632}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!