ID: 922148178_922148180

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922148178 922148180
Species Human (GRCh38) Human (GRCh38)
Location 1:222970027-222970049 1:222970048-222970070
Sequence CCTTTCTGAGATAGTAAATGAGA GAAACTCAGGAAAAGTACTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 243} {0: 1, 1: 1, 2: 1, 3: 19, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!