ID: 922150520_922150523

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 922150520 922150523
Species Human (GRCh38) Human (GRCh38)
Location 1:222999227-222999249 1:222999243-222999265
Sequence CCTAAACATCCATTTTGTGAATA GTGAATAACTAGAATTAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 45, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!