ID: 922176970_922176987

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 922176970 922176987
Species Human (GRCh38) Human (GRCh38)
Location 1:223204565-223204587 1:223204614-223204636
Sequence CCCACATGGGCACTTGCCCCTCA GTAGGGGACAGAGTGGCTATGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!