ID: 922180954_922180957

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 922180954 922180957
Species Human (GRCh38) Human (GRCh38)
Location 1:223232252-223232274 1:223232292-223232314
Sequence CCAGACTCCAGTTAATAATACTG TCACTAAGAGAGTAGATTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151} {0: 3, 1: 1, 2: 11, 3: 83, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!