ID: 922200344_922200348

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922200344 922200348
Species Human (GRCh38) Human (GRCh38)
Location 1:223395166-223395188 1:223395187-223395209
Sequence CCATTAAGAAAAAGGAGCAGAGG GGGTGCAGCACATTTCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 335} {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!