ID: 922212156_922212163

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 922212156 922212163
Species Human (GRCh38) Human (GRCh38)
Location 1:223494770-223494792 1:223494800-223494822
Sequence CCAGAGGGTCGTGGTCCCAGAGC TGAGCCCTGCAAGTTTCTCCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!