ID: 922233516_922233517

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922233516 922233517
Species Human (GRCh38) Human (GRCh38)
Location 1:223706093-223706115 1:223706114-223706136
Sequence CCTGGCAAGGGTGGGATGTAATA TACCCTAAGCTCCAACAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111} {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!