ID: 922235203_922235217

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 922235203 922235217
Species Human (GRCh38) Human (GRCh38)
Location 1:223717535-223717557 1:223717572-223717594
Sequence CCAATGCCTGCCCTTCTCAGACA CCCATCAGGGCCCAGGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 316} {0: 1, 1: 0, 2: 4, 3: 46, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!