ID: 922243335_922243342

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 922243335 922243342
Species Human (GRCh38) Human (GRCh38)
Location 1:223771303-223771325 1:223771350-223771372
Sequence CCAGCCAGACTCTGATCACAAGG GGACATGCAGTCTTGATGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 145} {0: 1, 1: 0, 2: 3, 3: 18, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!