ID: 922287231_922287235

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 922287231 922287235
Species Human (GRCh38) Human (GRCh38)
Location 1:224181049-224181071 1:224181088-224181110
Sequence CCTCCTGAGTTGAGTCCAATTAT CTGCCAATCCAGATGAAACTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 125} {0: 2, 1: 0, 2: 0, 3: 11, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!