ID: 922307709_922307717

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 922307709 922307717
Species Human (GRCh38) Human (GRCh38)
Location 1:224358318-224358340 1:224358371-224358393
Sequence CCCTCCCCAATTGAGCAGCAGTT TCTGAGTTTTAGTAGGTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 141} {0: 1, 1: 0, 2: 1, 3: 30, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!